EST 28746 is a singleton


Sequence

>28746 (1 EST) Length=196 ATATATATATATACAAATTTTACCTTTTCTGGGATATTTTCCATATACACAATTTTTGAAAAAACATCAAATTTGTTATT TTTTTCATTTAATGAGTTTTGAAAATCAACGAGTCTTTTTTTCTGTTCAGATATTACTTGTTTTTGTAAAAGGAGAGTTT GTACACCCTAAAAAAAAAAAAAAAAAAANAANTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28746: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28746319482T096500220m3gmbPfHB3.1, G. Roman Reddy


Date: 20:49:24 on Sun 19 Nov 117.