EST 28749 is a singleton


Sequence

>28749 (1 EST) Length=239 AAAATTTTAAATACATATATAACCTTTTATAGTTTNATAAAATATTTAGTTATATCTTCAGATAACTCATCCACGATCTG TAAAATTTCATTGTCTCCGTCAAATATATGAAACAATGATTTTATGAATTTNTCCTTTTCCTTATTAACCTGCTTATCAT TTTTATATTTGTTAATATGCTCATCATACAAACTTTTATCATTTGGNTTAAAATTATTATCCTTNGTGTTTNCATATNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28749319485T096530224m7gmbPfHB3.1, G. Roman Reddy


Date: 0:44:3 on Wed 22 Nov 117.