EST 28750 is a singleton


Sequence

>28750 (1 EST) Length=382 TTTCTTTCCTTTATAATTAAAAGTATAATTACTCAAATCTACATTCACATTTCCAATAATACTGAATAAAACAACTAATA CCGGAGAAGCTAAATAATTAGCTTTAATTAAAGGATGGACTCTGCCTTCAAAATTTCGATTTCCTGATAATACAGAGGAT ACAATTAAATCATTTTTGTTTATAACTTCTTCAACTTCTTCATCTAGGTGCCCACTATTTCCAATACACGTCATACATCC ATATCCGACATTATAAAAACCTAGTTGTTCTAAATATTTTAATAATCCACCCTGCTTCTAAATATTTCTGNACCGGTCTT AGGACCTGGGTGATAACGGGGCTCTTAAATTATTATGGGTAAANCTTTTAAGGTCCGGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28750: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28750319486T096540225m3gmbPfHB3.1, G. Roman Reddy


Date: 10:39:15 on Tue 21 Nov 117.