EST 28758 is a singleton


Sequence

>28758 (1 EST) Length=249 TATCCNGTGACATATACTCTTCGTATCCATTAACATTCCTTNTTTTATATATNAGAGCATTGTCTATGGATTCATTTATA TTATCAATGTTATGACTACTTATATCAATATGTGGGTTATATATTNCTGGTCTTTTTTTAATAATCTGGAATATATTCAT CATTGTATTTCTATAAGCATTGTTTTGAAACAACATATCTATTTCGTCAAATATTATANNAGATGGTATTATGTNATTGG ATATTTNAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28758: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28758319494T096620238m3gmbPfHB3.1, G. Roman Reddy


Date: 2:34:42 on Wed 22 Nov 117.