EST 28770 is a singleton


Sequence

>28770 (1 EST) Length=208 TTTNTTNGAACTTCTTAGTTACAAGGCTATTATAAAAGGAAAAGGAAAATGATAAACATGGAAGAACTAAAAGACGTACA ACCAGAAAAGGAGGAAGGGCTTGTTTTAAGTAACGACGATCTAATAAATAATAAACATAATAATGNCAAGAATACCAGTT CTTATGAAAAAGAAATGGATAATANCAATAAATCAAATANGNTAANTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28770319506T096740257m7gmbPfHB3.1, G. Roman Reddy


Date: 2:40:3 on Mon 20 Nov 117.