EST 28772 is a singleton


Sequence

>28772 (1 EST) Length=240 TATACATCACACCACATCATACAACAACTACTACATTACGAATGTTAAGCGAATATGGCGTACATACGTCAATTTATAAA AATGATGAAAATATGAAATCTTTGAAGGAAAATTTCGATCGACAAACGTCACAACGTTTTGAAGAATACGAACAACGTAT GATCAGAAAAAGAAAAAAATACAAAGAACAGTGCGACAAAGATATACAAAAAATTATTGAAAANGATAAANTGGNCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 28772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28772319508T096760260m7gmbPfHB3.1, G. Roman Reddy


Date: 16:1:29 on Fri 17 Nov 117.