EST 28778 is a singleton


Sequence

>28778 (1 EST) Length=250 ATATATTTTACTCTACACATTTATTTAAATGATAGGTATATATTTTATAAGTCAATAAATATTGTTAGAATGGTATTTAC CATTTGATTTGCCATTTTTGTAAGAGAGAAAAAAGGAACTCTCTCCATAAATATATTCATATAATAGGTTAATGAATACA ATATAATTCCATAATATCTTTCGTTTTCTTTTTTAAAAGATGTCATATAAAGTTACTATCACAAATATTAATTTAATAAC ATATTATTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28778: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28778319514T096820269m7gmbPfHB3.1, G. Roman Reddy


Date: 12:35:0 on Fri 17 Nov 117.