EST 28783 is a singleton


Sequence

>28783 (1 EST) Length=242 TATAAAAATATGTATACATTCAAATACACAAATGACATCATAAATTCCATTATATTATTATTTAATATATTTAGTAAAAG AAGTGATACTAAAAATATATCAAGTATGATTTTAAAAATATTGAAAAAATCACAATTTGATGAAAGAGATTATTCATGTA GCACATACATAANCATACTGAACTCATTTGCAAAATTAAGATATAGAAATGTTAATATGNATACATATGTTATTATTAAA TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28783: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28783319519T096870273m7gmbPfHB3.1, G. Roman Reddy


Date: 2:31:1 on Mon 20 Nov 117.