EST 2879 is in sequence 28793


Sequence

>28793 (1 EST) Length=302 TCTACATTATTTTAATAATAATTGTATTTAAACGGTAACTGAAAAAATAAAATAAAATAAAATAAAACAATGATTTTTTT AAAACGACGTTATGTAAATACTTCTACATAGTTTATAAATCGATATAAATATATATATATGAAGATTATGAGGGAATAAA ACATTCTCATAAACATATTGAACATATTTAACACATAATAACAAAATAAACGGTTTAATATATTTTATGTCTATGAACAC TACCCGTTTATCAAAAANCACAATTTAAAANTAAAACGTTCATTATCATAAGTCACAAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28793: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28793319529T096970287m3gmbPfHB3.1, G. Roman Reddy


Date: 2:34:52 on Wed 22 Nov 117.