EST 2880 is in sequence CPlasFal_644


Sequence

>CPlasFal_644 (2 EST) Length=687 NATAATGNCNACAATAATAATATGATAGTTTTATATANTATTGTAANTATAGAGTGATTTTGTTATAATACAAAGAATTT CAACTGTACAAGAAATGACGTTANCCCTTTGACGTATAAAAAGCCCCGTGGGTATAACGCACCAAGAGAGGTGGAGAAAA ACTACATTTGAGTTTTTATTATGAAGGAAAATAATCGTTTCTCATATAAAAGCACACATATATATATGTATATATATATA GTAGTCTTTTTATCAAATGGTATGTTATTCNTCGAGTTGTTTGCGAATATAAATAATTATAATGCTTTTTGCGAACACGG CAGACATAAAAACGTATTTATGTTTTTTTTTTTATATGTTTATATAAAACTGCAGTTAGTAGTGTAGTAATGATATAGTT AGTAGTATTCAACGATGAAGTCGGTATAACTATTTATGAATTAAATCCTTATGAAGGTGTAACGCGACCTTCGAAGGTAG AGAATTATGAAAAAGGAATTTATTTACTGTTACTTAAATGTAAATATACATATTCCATTAATATCTCTTAGAATCTGATT GCGAATATAAATATTTTACCTGCGAATATTGATATCACGTNTATGTGTTATTTTTAAGATGCTCATTTTGTTTTTATTAA CGTTTGCGTATTCTTATTAGGTACACATATTCGNGATAATATATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CPlasFal_644: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28801319537T097050294m7gmbPfHB3.1, G. Roman Reddy
5045951674779N977611212C3czapPFDd2.1, Debopam Chakrabarti


Date: 8:25:39 on Thu 23 Nov 117.