EST 28800 is a singleton


Sequence

>28800 (1 EST) Length=304 TGGATAATATGAATGCACCTAATGGAGTAACAAACCTCAATGTGGGCATAAACAATGAAGTAGTAAAAGAAGAGAAAACT AATACTTGCCTAAATATAAATGAGCAAATACATTCCCATACAAAATTGAAATGTATCAAAAATGGGAAGCCTAGAAATAT TAATCAGAAGGNAAATAATGTAGTATATATTGAATCTGATAATTCTCATAATGACAATANTAATANTAATAATAACAACA ATAATAATATGATATTTTTNTATATTATTGTANTTATAGNGTGNTTTTTTATAATNCAANGGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28800: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28800319536T097040294m3gmbPfHB3.1, G. Roman Reddy


Date: 19:48:40 on Fri 17 Nov 117.