EST 28802 is a singleton


Sequence

>28802 (1 EST) Length=398 TATATATATTTATATTTATTTATTTACCCCACTTTTTAGGAATACTATAGCTGTAATGAAATTTTAGAAATGATATTAAA AGGAGATCTACATAAAAATTGTCTCATAAAAAGAAAATCTGATTCGCAATATTTTACTTTAAAAGAAAAAATAAGCGAAA TTCATTTTTTAAAATATCTTGAGTTACAATATTATTTGAAAAAACAAAAAAAGGAGTATCATATGAAATCCAAATTAGAA AATAATTTTGATAAAGAAAACACATTATATCTAAAATTTAGTGAATCTTTATTAGGCGNAAANGTAAAGTCTATAAGGAA TTTCCTCATATCTCCCTTATGNTAAAGGATGTGGTAGGNGGTATATTNATNCCATGCNCAAAAATTTTGGGTTAATNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28802: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28802319538T097060296m3gmbPfHB3.1, G. Roman Reddy


Date: 10:39:37 on Mon 20 Nov 117.