EST 28804 is a singleton


Sequence

>28804 (1 EST) Length=359 AATATATATATAATTTACATATAAAAACAACAAAAAAAAATAATAAAAAATAACATACATATATTAGATATATATTTGTA TTATATATTCCATATATCCGATATAGGNTATTCCTTTTCAAAAATCTCCTTTTTATTATTAGCAATATTCATTTCAATGC ATACTTTATTAGGTACATCAGCTTTATTATTGTCCACATATATATGACCCATAGGTTTTTTTTCATCATCTATATCAAAN TAAGTGATATCATCCTCATAAATATCATAGTAGTAGGGTTTNCGATGTTTTTCCATATCATCAAAGGTAGTATCCGTAGT AGGATTTATGNNGGGTTTGTNTACATATTTGTATATTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28804: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28804319540T097080312m3gmbPfHB3.1, G. Roman Reddy


Date: 2:44:55 on Mon 20 Nov 117.