EST 28812 is a singleton


Sequence

>28812 (1 EST) Length=423 GGTGAAGAAAGTAAATAAGTATACATCACACTGTGATGNNGGTGTAGTAGAAAAGGAATATGAGGATACAATGAAAAAGA AAAACAAAAGAAAAAATAAATATACATATGAAAATACTAATGAAAATATTAATAGTTTACAGANTAATAGTGGAGTGGAA TATCCTGGAGGACCTATAAGATCTACTTATGGTAATAATTTATCTAAATGGATGANGGATTCTTTAGAAGATATTAGAAC ACCAGATTCTATTAAAGAACCTGGNTTAGGTAATATGTTAATACAAAGTTTAACAATGGNTAAAGGTTTTATACAATCTG TTGCAAGTTCTGTAGTAGGTATTTGTNCNTCCATTAATTCCTCCANCCTATATTGGGTTTAATAGGCCCTTTACCCATNG CTTACCTATGGNTANCAGGGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28812: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28812319548T097160317m7gmbPfHB3.1, G. Roman Reddy


Date: 18:52:14 on Thu 23 Nov 117.