EST 28820 is a singleton


Sequence

>28820 (1 EST) Length=350 TTTANCAATTTATGCCATCTNTNTNTTTTTCTTTTTTCGTTTTAAATCTTTTTATTTCTNCAACCATTATCCTTACAGTT TAACAATTAAAGATATTTATGAACACGGNGTAAAAAACCCATTTACAAAAATCATCCATAAATTAAAGAAATTTATACGT TATAGAAAAGTATTAAGATGGTCACGTATGTGGTGGGTATTGTTAGTAAGNGAAATTGTTGGNGATAACACCATCGNNAA AAAAACAGAAAAGGTAACTTNTAATCAANAGNGATTTATATTNTCTTANTTATCTANTTTATTTACTCGTCTAGCTAGTT TTGTGTGTACCCATGGTTTTATTTTTACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 28820: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28820319556T097240322m7gmbPfHB3.1, G. Roman Reddy


Date: 2:35:2 on Wed 22 Nov 117.