EST 28825 is a singleton


Sequence

>28825 (1 EST) Length=248 TATTATCATGAATTGTTAAATTTAATATATCCGTTTTATTTATTATCCCTTTTAGAAAATTCAAATGGTCATCATAATTA ATATATTTTTTTAATATCCCTTGNGTATTCACACTGTGGTTAATCTTATTATTTTTCTTATCAATGGATTGAAAAAGNTG ACTCATCAATTTATCAGACATTCCAAATAATTTATCGAATACCTGTTCATGTATATNNTNACATATATTNTTATCAATAT AAANTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28825: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28825319561T097290328m7gmbPfHB3.1, G. Roman Reddy


Date: 0:41:54 on Wed 22 Nov 117.