EST 28826 is a singleton


Sequence

>28826 (1 EST) Length=294 TAAGATATGCAATTACTATTAAATACACAAAATGAAGACTAAGAACTTACGAAAAATCAATTATATTATTAGTTGAAAAG GGATTAGGAAAAGGTTGAAAAGGGTCATTTTGCAAATTTTCACTAGATGCACTTTTTAAATTTGTAAGATATTTTNGTGC TTCNTTTTCAAGAAATGGNCCTCCACCTAAACCAACAGGNAGTTCGAGGAGTCTAGTAACCTTATCAATCACATCACCAA TAGTTATATCCATTGTTGTCGNTATTTTACACACATTAATAGCATNTNTTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28826: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28826319562T097300332m3gmbPfHB3.1, G. Roman Reddy


Date: 23:47:3 on Sat 18 Nov 117.