EST 28827 is a singleton


Sequence

>28827 (1 EST) Length=280 TTATTATTATTATTTATTTTTTTTTTTTATTTTTATATAGATCCTAAACATGTTATCTGTTATGGCTTTAGTTCCTGTCC AGGGATAGCCANAAATATGGAAGCAGCAAAAAATTATATAGGNGGAGAAAAAAAACAAAATGAAAATATCAAANTAAGTG CTGTAAATCATATATTTGCGCACATTCTTTCACCACTATTTTTTAATTTTTATAATGATAAGCATACGTNCACAAATAGT GCTGAATATAAAANTGNAAATNTAAAAGCAGNTGATGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28827319563T097310332m7gmbPfHB3.1, G. Roman Reddy


Date: 6:5:48 on Wed 22 Nov 117.