EST 28829 is a singleton


Sequence

>28829 (1 EST) Length=324 TATAATATGTCTATACCTCCGTTATATATAACATTATCTAATAAATTTAAATACTCTTCATCTTCAAATATTTCTGAAAG AAAAACGTTTCTAGTATGCTGGGTGTCGTTATAATAATCATCCACAATTTTGTTGTTAATATTATCCNCAATTTTGTTGA TAATATCATCGNCAATTTTGTTGTTAATATTATCCTCAATTTTGTTGTTAATATCATCCTCAATTTTGTTTTTATTATCA CCCTCAATTTTGTTGTTAATATCANCCTCAATTTTGTTGTTAATATCATCCTCAATTTTGTTTTTNTTATCACCCTCAAT TTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28829: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28829319565T097330334m3gmbPfHB3.1, G. Roman Reddy


Date: 12:32:38 on Fri 17 Nov 117.