EST 28832 is a singleton


Sequence

>28832 (1 EST) Length=420 ATTTTTTGCAGTCTTATTAGATGAATCTACTACATCTATACAAAATGGATTCTTCAAATATTTTGATGAGATATCTTTTA TCCATGATGGTGTCGTAGCAGAATACAACAAAACTTGTGCCTCTTTTAAATTTATATTGCTTAATATTCGTTCTATATCA TGGGTAAAACCTAAATTCAGCATTTCATCAGCTTCATCTAAAACAACATATTTAATATTTTGTAAGGATAAATTCTTTTT TTCAATATGATCAATAATACGGCCAGGGGGTACCTGTTAATATATCAATACCTTTTCTCAATTTATTTTCTTGATACGGG TTAACTTTCACCTCCCATTAATTGGGCATAATATTAANAATTATAAAAATTTGGGGTAAATTTCCTTTNAAGGGNATTTT CCACCTTTGGTTAGGGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28832319568T097360337m3gmbPfHB3.1, G. Roman Reddy


Date: 15:0:26 on Wed 22 Nov 117.