EST 28833 is a singleton


Sequence

>28833 (1 EST) Length=269 TATATTTTACGTTGAAAAAATTAAGAAANGTGCTGATTGGCTGTTAATTTGTTCCATAACAAATNTATAAATTCATCAGA TTGTAAAATTTCTTTAATTATATTATGTATCGTATTTCTATTTAACGNTATACTTTTATTTTTAAAATTACTTGTATTTG TACTTATATTATTATTTGTATGTNCATATTTATTATTATNTTTNTCATACTTGACGATATGATTTGTTTCTTCAAAGACA GATCCATTATTATGAGAGTNATTTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28833: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28833319569T097370337m7gmbPfHB3.1, G. Roman Reddy


Date: 12:0:35 on Thu 23 Nov 117.