EST 28836 is a singleton


Sequence

>28836 (1 EST) Length=346 TTATTATTATTATCTGTACTGCTAATATCTTTTGTCACATTTGATGTATCTAATTTATATGTCTTTTGTTTATTTGTCAT ACTTGAATGATTCATATAAATTTTGGCATAAATTTTCATAAGGTTATTTTGAAAAATGAGACCTTTATTATTTTTCGTAT AAAATATTCGCATAAATTTTTTATGTTCATTAATTTCCTCGTCTGTTATAAAATTGGAACCCATTTGTGTATTTAAATAA TTATCTAAATGTGATATATTTTGTTCTTTTTTATTACACTTATTAATTATTTTTTCCCAAGGTTGTAAAATAATTTTNTT CCATTTATATTGGTAGNCATAACCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28836: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28836319572T097400339m3gmbPfHB3.1, G. Roman Reddy


Date: 11:42:53 on Wed 22 Nov 117.