EST 28841 is a singleton


Sequence

>28841 (1 EST) Length=379 TATTAATAACACTACAATATTAACTACAGAAAAGATAGTAAAGATTAAAATATATGTTGTTCGGAATTTTTTCTTTTTTT CTTTTTCTTTATTGTGTAAATAAGTTTCTTCAGCTTCTTCAAAGGTTCTAGGACATATATGTTCATGACATATTGTAGAT TCTGTAATATTAGAACATGCTTTTGATTTCGTTTGATCTGTGCTTATTTTTACTCTGATCTTAATTCCATAATCACATGT TTTAGAGCAAGCACTCCATTCAGACCACGCATCACAATGTGCATGTTCATTGAGTAATCGATTGTTTATAAAACTTTTAT TATATCTGACATCACTATTACCTCTAAAATAAAAAAAAAAAANTTNTATNTATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28841: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28841319577T097450343m7gmbPfHB3.1, G. Roman Reddy


Date: 7:21:57 on Mon 20 Nov 117.