EST 28844 is a singleton


Sequence

>28844 (1 EST) Length=409 TATTTTAACAAAAATCAATAAACAATAATTATGATATCACGTAAAATATTAAATTACGTTTAATATAGCAACAGCAAAAC ATAACTATTCCTTTAATAATTTTATATATTGTAGTTTTTTCTTCATTTTTTTCGTTCTACGATAACGTAAAATTAAATAA ATAATAAACATAATCAAAACTATAATCAATATTGCAAAGATGGAGGCTATTATAGCAGTATGGTAAGTAAAACATGCAGC TTCTACAGCGTTTTTGTTTGATTCTATAAGTGCTGGCGTGATTTGTTCAGTAATATCCTTAGCAGCTTGTGCAGCAGCAT TTGANGGCTTTGAAACAACGGTTTGTGCATTTGCTACTATGTATTTCTCAAAAAAATCAGCAGGCTCTCCTGAATTTGCC AAGGGNGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 28844: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28844319580T097480345m3gmbPfHB3.1, G. Roman Reddy


Date: 23:17:41 on Mon 20 Nov 117.