EST 28845 is a singleton


Sequence

>28845 (1 EST) Length=363 ACTATGCGNATGCGACCTATATAGGTCAATTTATGACAACAATCCAGAAATGAAAGNTGTGATGCAACAATTTGATAGAA AAATATCACAACGTTTTGAAGAATACAATGAACGTATGATTAAAAACAGACAAAAATGTAAAGACCAATGCGATAAAGAT ATACAAAAAATTCTTTTAAAAGATAAAATAGNAAAAGNATTAACAGAAAAGTTAGCGGCATTGGACACGAATATATCTAC TGAGGNTATATCTACATGTATTTGCGGAAAATCAGTAGCAGACAAAGTGGNAAAAACATGTTTGCAATGTGGAGAAATAT TATGTACGGCGGTCCTGANTTGGGTTTGATAGGTGGGATAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 28845: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28845319581T097490345m7gmbPfHB3.1, G. Roman Reddy


Date: 19:18:19 on Thu 23 Nov 117.