EST 28846 is a singleton


Sequence

>28846 (1 EST) Length=418 CATATATATATAATAAATTCTTTATAGGTGCATAATAAAAATAAATCATACATCACATCACAACATACACGAAGTACTAG GTTATTATGCGAGTGTGAATTATATACACCCATTTATGATGATGAACCGGAAATGCAAAAAGTATTGCACGATTTTGATC GTCAAACCTCACAAAGATTTAAAGAATATGACAAACGTATGCAAGAAAAACGTAAAAAATGTAAAGAACAATGCGATAAA GAAATACAAAAAATTATTTTAAAAGCCAAATTAGNAAAAGANTTAATGGNCAAATTTGCCACACTACACACAGGTNTNCA AAGTGATGCTATTCCANCATGTGTTTGCGNAAAATCCTTAGCGGNTANACCAGNAAATTTTTTGTCTAANCTGTGGGTAA AATTATGCCAGCGGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 28846: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28846319582T097500346m3gmbPfHB3.1, G. Roman Reddy


Date: 4:35:7 on Thu 23 Nov 117.