EST 28847 is a singleton


Sequence

>28847 (1 EST) Length=419 AATAATTAAAAAATTTTCAGATAACCAAATATAATATATGCATAAAAGTAATACATATAAAAATATAATTAATAATAAAT ATGGTATATTCAACTAAGGCTAATGCATACATAAATGTTACCATCAAGNATACCTAACGNCATATATCTATTCTTCTAAT AGTTTTATATATTGGAGTTTTTTCTTCATTTTTTTCTTTCGTCTATAACGTAAAATTAAATAAATAATTACCATAATTAA AACTATGACTACAATTGCAATAACAGAAGCAATTATTGCAGTAGTTAAACTACTAGTTACACTGGCTCCCTCTTTCAATA CACCTTCTTTAGCATTAGCAAAAGCCGTTTCAACTGCTGTTGCTTCTTTAGGTAAAGGNTTTAAGTGTATAAGGGTTTCT GAGCTATGCCTTGTACTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 28847: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28847319583T097510346m7gmbPfHB3.1, G. Roman Reddy


Date: 23:5:46 on Wed 22 Nov 117.