EST 28864 is a singleton


Sequence

>28864 (1 EST) Length=391 GTGTACACTATATATGAAATAAATACACATGTGTACATATATTTATTATATATATATATATGTATGTATTTATGTATGTA TTTATTTATTTTTATGTCTATAAAGGGATTTTCTATAACACTCCTAGACATATATACATAAAGATGTAATATTTACACTT CTTTTATTATACAGATAAAGAAGAAAAAGAATATTTAACAAGAATAGGAGTAAATGATGCTAATGATTACAAATTATTAA CGGAAAGCCCATGAAGAATATATAGATACAGTTACTGATATTAAGAGCAAATTAAAATATAAGGNTACCTTTTTTTTCAT TACACAAAACCTTATTCAAAAAAATTTTATATGGNTTTTTAACCAAAAACCCAAAATCCACCATTTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28864: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28864319600T097680360m3gmbPfHB3.1, G. Roman Reddy


Date: 14:43:50 on Sun 19 Nov 117.