EST 28868 is a singleton


Sequence

>28868 (1 EST) Length=377 TCATCAAAGAATGAATGTTACAAATGTAGTAAAAAGACGAAAGAAGTTATCTTATTTTCATTCACTTCTTCTGATAATAT TTTCTTTTTTTCTATCATGTGCTAGAGGCATGGATTATTACAAAAGACTGGGCGTTAAACGGAACGCCACAAAAGAAGAT ATTTCAAAAGCTTATAGGCAGCTAGCTAAAGAATATCATCCAGATATAGCGCCCGACAAAGAAAAAGATTTTATAGAAAT TGCAAACGCCTATGAAACCGTTATCAGATCCTGAGAAAAGAAAAATGTATGATATGTATGGTGAGGNCTATGCCCAAGGA GGTATGGGTTGAGGANGTNCCGGGAGAGGGGACATGCACATGGTTTCNTTTTTGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28868: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28868319604T097720362m3gmbPfHB3.1, G. Roman Reddy


Date: 16:16:48 on Fri 17 Nov 117.