EST 28869 is a singleton


Sequence

>28869 (1 EST) Length=391 GTTTATAAAACAAATAAGTTATTCACTTAATATGATGAATGAAACTGCAGCATCAGCTCTACTACAACAAGTACAACTAC TACAAATAATAATAATAATAATAATAAAATTTTTTCAATTCAAAATATAACAAATATTACCGCAAATAAAGAAGTACATA TGATGAAGAAAATATTAATGACTACCAATATTTATATGTTAATATTTTCAGCTATTTTTATATTACTTCATTCCATATTC TCATTTTTCGCATTCAAAAATGATATGCAATTTTGGTATAAAAATGGAATCTATGGNAGGGTTATCAGCATTAAGTGTTA TAACAGCATTTGTTTTGTGNTATTATATTAGCCTTATATTTTATATGGGTTCAGGCAAAACCATCATGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28869: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28869319605T097730363m3gmbPfHB3.1, G. Roman Reddy


Date: 14:2:25 on Mon 20 Nov 117.