EST 2888 is in sequence CPlasFal_745


Sequence

>CPlasFal_745 (2 EST) Length=547 TATTAACTTAGGTCTTAACTTGACTAACTAAGGTCTTAACATGACTAACATAGGTCCTAACTTGACTAACATAGGTCTTA ACTCAACTAACTGAGTTCATACTTCGACTAATGTAGGTCTTACTTTCACTAACTCAGGTCATACGTTTACTAACGTAGGT CTTACTTTCACAGATATAGGTCTTAATTTCACTGATAACAGGCCTTATGATTACTAACTTAGGTTTTTATGGTTACTAAG TTAGGTCTTAAGATCACTAACATAAGTCATTAAGGTACTATGTTTGGTCTTAACTTAACAAATGTAGGTCCTAATATCAC TAACCATAGGTCTTAGGTTGACTAACCTTAGGGCTCACGGTAAGTAATGTTAGGTCTTTAGGGTAAAGTAATGTAGGTCT TATGGTAACTAATATAGGTCCTAATATCACAAACATAGGTCTTATGGTTACTAACTTAGGTCTTATGGTTACTAACTTAG GTCTTATGGTTACTAAGTTAGGTCTTATGGTTACTAAGTTAGGTCTTAAGGTCACTAACATAAGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CPlasFal_745: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28888319624T097920375m3gmbPfHB3.1, G. Roman Reddy
28889319625T097930375m7gmbPfHB3.1, G. Roman Reddy


Date: 16:18:30 on Fri 17 Nov 117.