EST 28881 is a singleton


Sequence

>28881 (1 EST) Length=399 TTATATATCTGCATTTTTAAAGATCTGGAGGTATGTTAGCTATAATGTCCTTCAAATATGCAGATAATCTATATCCAGCT AAAACCATTTGACTGTTTAATAATTTTTTTGTGTTTATAACAAAATGTTGATTAATTGAATATTGTTCACTTCTTTTTAA ATCTGTCAAAGGAAAAAAGGAATAAATATTTTGTACTGCGATATCATGAGATTCATGTGCTATATCATCAATATATTTNA TTTTATCATGAGGTAAAAATAGTTTGTTACCGAAAGATTCTGGTGGATAAGTGCTCATAAGNTATCTAGCATCTCTTTCT ATATTTGTCATATTAATATTAGGCCATTGTTTTTTNCTTGNTTTAAATAATATTATCNCATAAATAATGCAATTTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28881: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28881319617T097850371m3gmbPfHB3.1, G. Roman Reddy


Date: 16:30:34 on Fri 17 Nov 117.