EST 28882 is a singleton


Sequence

>28882 (1 EST) Length=400 GTTGGTGTCCATCAAATTATGCTCATCTTACATATGCACCATAGCATGATTTGCCTTGTACACAACCGTTTTAATAATTT TATTATATAATATCATAAAATGATAATTTTGTTCCTATTCTGTATAAGNGTATTTATTAATATAATAGCTAGCTGGTCAG ATGAACCACACATGCTCATAAGTTATATAGCATATATAAATTTAAACGATGGTGAAAAAGAGATACTGAATAGAATATTT CAGAATGGAAATGACGCTATTTTTGATAATCCAATAACAGCTTCTATATGGGCTGATAAAATAAAACCTAATAACCATAA AAGNACATTTCATTCCTCTAATTTTCGNCGNAATGNTTTGTTAGGTATATTTAATGAATGGCATTATGTNCAATTAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28882: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28882319618T097860371m7gmbPfHB3.1, G. Roman Reddy


Date: 18:33:7 on Sat 18 Nov 117.