EST 28883 is a singleton


Sequence

>28883 (1 EST) Length=239 TATTATCATATGTATCATTTACTATTTGTACTTTCGCGAAATACAGATATATGTTTAATTATATTAAAAATTATTATTAT TAACGTTTCTTTTTTTTAATGGTTATAATATATTAAGNAAAATTTTGTCTCCTNTTAATTGTGCAACAAGGGTTTATATA TTTTTATAGTGACACTATATGAAGGATAGCTATACATAACANCAACCCACAAAGTATTTTCTACAATATAAATAANTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28883: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28883319619T097870372m3gmbPfHB3.1, G. Roman Reddy


Date: 15:59:2 on Tue 21 Nov 117.