EST 2889 is in sequence 28890


Sequence

>28890 (1 EST) Length=344 TCCATTATTCTCATTTGATTGATTATTTTTNAACATTTTATTGTTTAAATTATTATTTATTATTTCATCTTTCTTTAGGT CTTCGTTCTTTGATTCGTTATTTTCCGATATATTCATTACGNAACCTTTTGCTCCCATACTTTTTTTTGTTCTATCAAAA GCTCTGGGTGTTAGCATATCATCATCTATAATATCACTTTGTGCATTCATGCGGATTTCTTTAAGTTTGGTAGATGATAT CTCCATATTTNTTTCTTCCTTTTTAGTATTATATAATNNGGTTCTTTTTTGTATTTGTTTCTNTATACGNTTATCCTNTA ATGTNATTCATAATAATCGGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28890: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28890319626T097940376m3gmbPfHB3.1, G. Roman Reddy


Date: 20:48:34 on Tue 21 Nov 117.