EST 28906 is a singleton


Sequence

>28906 (1 EST) Length=389 TATATATATATATATTGTATCCCTATTTTTTTNTTAAAAAAGTTTTCAATAGTTATTTAAAAAAAAAGTTAACTCATTTT CTAAATCTTTTAGTGAAGGATCTAGTTGGTTATTTGTTTGTAAAAAATTAAATAATAGATTTACATGATCTTCTAATGAT TTTTTTTCTTCAGTTTTTTTATATTCATTAGAAATNAATTTTTGAGCTTTGTCATCTTGCGTAGAATCTAATTTTATTTG TCCTTCAAATATATCATTNCTAGTATTTTNATTAATATCTTCTAAATTNACATTATCCTCATCATCTTCATTTTCTNGTA ATTGATCTTCCACAATTNCGNTTTCANCCTCCATAACTNCNGTTTCTNCAGGTTCGGCAGTATCTNCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28906: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28906319642T098100391m7gmbPfHB3.1, G. Roman Reddy


Date: 10:5:2 on Fri 24 Nov 117.