EST 28911 is a singleton


Sequence

>28911 (1 EST) Length=334 TATTTATTTATTTATAATTATTTTTTTCCCCTTTCCTTTTTTTTTTTTTTTTTTTATTTATTTATTTTTATTGTCATTAT GGCTAAATTGTCATTAACTATTAACAATGTTGATGATGATTTAAAGCGAAAGATTAAGAAGGCAAAATTCGAGGGTGTTG AAGATCTGAAACATAAAANCAAAAAGTTGACCATTTCTTATAACCCGAAGGTTGTGGATTCTTATGGAGTAATAGAACGT ATAAAACATTTGGATATTAATGGTGAAATTTTAAAGGATGATAATGATATAAGTAGTAAGNNCGGTAATAGTTTCACNTT TTCANTGTATAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28911: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28911319647T098150401m7gmbPfHB3.1, G. Roman Reddy


Date: 4:23:37 on Mon 20 Nov 117.