EST 28915 is a singleton


Sequence

>28915 (1 EST) Length=302 ATAACATTTTTAATAGTGATAATGATGATATTATACATCACAATAGACATGATGATGATTTCCTTCCTAATAATTACAAT GAACATGATAATTATAATGATGATTTCGATTTTGAAGAAAAACAAATAAAATATTACAATAAATTAAAAGAAAATAATAA CGAATTCTTTAATAAACTAAAAATATGTTCAGTAAATCAANAATTTANAAAGTTANTACCATTTTATACGATACATGGTA ATCATGATTATCCATATAGTTATGANTACATATCGCCATTAGNTATATTAAATATATCTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28915: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28915319651T098190403m7gmbPfHB3.1, G. Roman Reddy


Date: 14:8:58 on Fri 17 Nov 117.