EST 2892 is in sequence 28926


Sequence

>28926 (1 EST) Length=366 GTTAACACATTTATCATCATATAAATAAGCGACATCTTTTTCGTATGTTAAATGTGCGAAATTATTATTACCCTTTGAAT ATATAATATCTCTTGGNTATTTTAAATTTATAATTCCNTCATCATTTAATGTACTTGCACCAACACTCTTCTTTGGTTCC ATTTCTGAATATTTATTCTGNTGTTCTTTATTTGTTCTATTTCTCATATATGAAATAATTTTGTCTCTTAATTCTTTCCT CTTAGAATTAAAAGNTATATTGCATAACATTTTTNTTTCTTGAAAAAGTGNTAAATCATCGGTATTAAAACTACTTCGGN CAATATCTAATTCAGGGGTNTTATATACCATTATAAAAATATATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28926: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28926319662T098300410m3gmbPfHB3.1, G. Roman Reddy


Date: 23:32:42 on Fri 17 Nov 117.