EST 28921 is a singleton


Sequence

>28921 (1 EST) Length=69 AGAGAAGATATTGATAAACTTAAACAAGGAGTACATATGGTTGTTGGTACCCCAGGTAGAGTTTATGNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28921319657T098250406m7gmbPfHB3.1, G. Roman Reddy


Date: 16:30:42 on Sun 19 Nov 117.