EST 28929 is a singleton


Sequence

>28929 (1 EST) Length=287 GTGTTTTTTTAAAATGACCAAATAAATAAAATATGTATAAATATATATTATTGTGAAATAGGAATTATGTACAGGAAAAA ATATTTTGATATATATAAAAAGAAGGAAANAAAAAATAATGAAAATTGANTTTCCTTTATGTATTATTATACCACATATG ATAATGTTTTATATTAATAAAGATTTTTTGAAATTNCAAAATTNCATTTTTTAAGNNATNCAAATATATTTAATATTANC CNTTGANATTATATATAAATNTTGTCTTAATAGNGNTATGTGTTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28929: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28929319665T098330411m7gmbPfHB3.1, G. Roman Reddy


Date: 17:51:34 on Tue 21 Nov 117.