EST 28933 is a singleton


Sequence

>28933 (1 EST) Length=281 GTTTATTTTTATAATTTTTACATTTATAATGGTTGAGAATGAATTAATTAATGAGAATAACTTAACTCATAAGAGGTTAG ATGGAACGCCAAAACTTGATTCCTTTTTTAACAAGGATGGTTTATTAATTGGNACATATTCCTGGACAGTTAAGAAGGCA ATAGGTATATTAGTTTTAATTCATGGTTTAAATTCTCATTTTCGGTTACAATATTTAAAACATAATGCAGATATCATNAG TNATGATAAAGCAGTATTGATAANTTCAGATGANTATNATN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28933: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28933319669T098370414m7gmbPfHB3.1, G. Roman Reddy


Date: 21:49:36 on Sat 18 Nov 117.