EST 28936 is a singleton


Sequence

>28936 (1 EST) Length=328 TAATCACCTGAGTATATTTATCTATGACCATAAAAGTATTAGGAATATTTGTGTCTCCCATATGAATCATACTCGATCCA ACCCAACCACCAACTTTCTTTTGAACGTTATGAAGAATTTTCCTCATAACACCAAGGACCGTATGTCCACTTTGCATACG GTTTAATCCTTGTCCTGTATCAATTAATCGATATGGATTTNNTAAATCTAGCATATCATTTNCTGCACATGTCCATAAAA AGGAACATATGNCCTCCTATTNCTCTCCATAAGTATAATGTTTGCAAAACATACATATATTGTCTACTATGTGAATGTGT TAATCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28936: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28936319672T098400417m3gmbPfHB3.1, G. Roman Reddy


Date: 17:56:35 on Mon 20 Nov 117.