EST 28937 is a singleton


Sequence

>28937 (1 EST) Length=288 ATAAATATATTGTAGAAGGAGCAAATGTATTTATTTCAGATGATGCTAGAAATATTTTAGAGAGTAAAAATGTTATACTC TTTAAGGACGCAGCTACAAATAAAGGAGGGGTCATATCTAGTAGTTTAGAAGTTTTAGCTGGGTTAGTACTAGATGACAA GCAATATATTGATTATATGTGTTCGCCTGATAGTGACATTCTACAAGTTGATGAAAATGAAATTAATNTTGTTCATCAGA ATCAAAAAATGTATCATTCCTTATCATTTAAAAGGGGTTCTATAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28937319673T098410419m3gmbPfHB3.1, G. Roman Reddy


Date: 13:24:21 on Thu 23 Nov 117.