EST 28941 is a singleton


Sequence

>28941 (1 EST) Length=281 TTTGTTTGTTTAATGAAATATATTTCACATACATTTTATTATTCTTATGTATATTTAATATTTTAATNATATTATTAATA TATATAANATNATGATTCGNGGGTACAGCACAATGTATTTTTGAAACATCATCATGNTTATTAATATTTCGATTAAAACA TTTTTTGAAACTAAAAAAATCTGAACAATTAAGGNANTGAAAAAAGAAATGATAAAANAGTAAATAANAGTTGTTACATA CAGGNACAAANGGAAGCAAAGTCCTTTAANTTTNTAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28941: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28941319677T098450422m7gmbPfHB3.1, G. Roman Reddy


Date: 19:53:52 on Fri 17 Nov 117.