EST 28947 is a singleton


Sequence

>28947 (1 EST) Length=446 TATATATATATATATATNTCCTTTGTGTGACAATATTGACACATTATATACATTCACTTATATATAGAGATAAATGTTTG CTTATTTTTGTTTTTATGATATTGTTCCTTGATTTAAAACACAAGTAATATCACCTTGGGATGATATCCATTTGGTATCC TTATAATGAGCCACACCATCTTTTAATATAAGATGTGGTTGNATATGGCAGAAAGGATTTTTTTCTTTATCAGAACTAAG NTTTTTATCTGGTATAACATTAGGGTCCATATTTTGAAATAAGATTCTTTCTCCTATTTTNACACCATTTGGTGGNNCAA GTAATTCTACTTTTTCNTANAAGGGCCACATAAAACCATTCCATGNCTTTTTTTTCCNCTTAAAGGTTTTCCNCTTAAGG TAGGCTAAAACTAAACANATTTGTTAAGGAAANCTTCAGCGTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28947: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28947319683T098510426m7gmbPfHB3.1, G. Roman Reddy


Date: 22:7:44 on Sat 18 Nov 117.