EST 28952 is a singleton


Sequence

>28952 (1 EST) Length=294 TATGTTTCCTTTATAAAATAAAAAAAGGTTATCCTTTCAATATACTCTAACAATGGAAAATTATAGAAGAGCATATCACA GTGGCTCTTGGTATACCAACAAAAGTAATGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAAAAACGGATTAT NAAGNNGATATATTAAAATATAATATGAAACAATCACATATATTATACCCTTTTTATTTTTTTATATATTAGGGGNGGNG TTGAAAAGTAAAATTGGGGGGCCATTTAAANGGGCAANTGCCCAAAGGCAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 28952: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28952319688T098560429m3gmbPfHB3.1, G. Roman Reddy


Date: 2:52:33 on Mon 20 Nov 117.