EST 28953 is a singleton


Sequence

>28953 (1 EST) Length=300 TATATAAATATATATAATACAAGTTATATATATATATATTTTTGTTTTTATTTTTTTTTATGTGGTTTTATAATTTACGG GCATATGGCTGCCTTGACATTTTGCTTTTGTGCATTTGCTCTTTTAAATGACTCCTCAATTTTACTTTTCAACACCTCTC CTAATATATAAAAAAATAAAAAGGATATAATATATGTGATTGTTTCATATTATATTTTAATATATCATNTTAATAATCCG TTATTTCAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAAAACCATTCCTTTTGTGGGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 28953: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28953319689T098570429m7gmbPfHB3.1, G. Roman Reddy


Date: 0:19:50 on Sat 25 Nov 117.