EST 28960 is a singleton


Sequence

>28960 (1 EST) Length=370 TTATAAAAGTATTAAGAATTTTTTGAGAAGTAGTGAAATACAATGATACAAAAAAGAATATNAAAGGCGAAAGATAATAC TATATAATTACTGACACTTAAAAACGAAAGCTAAGGTAGCAAATAGGATTAGATACCCTAGTAGTCTTAGCTGTAAACTA TGAATATTTTATATTTATATTTTATAAATATAATAACTAACGTGATAAATATTCCGCCTGAGTAGTATATTCGCAAGAAT GNAATTCAAAGGAATTGACGGGAGCTTATACAAGTGGTGGACATGTGGCTTAATTCGATGCAACACGNTAAACCTTACCA AAATTTAACAATATTTTTAATATTAGGGATTAATATTTTNATAAAATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28960319696T098640433m7gmbPfHB3.1, G. Roman Reddy


Date: 14:27:48 on Sun 19 Nov 117.