EST 28966 is a singleton


Sequence

>28966 (1 EST) Length=232 ATATATAATATAAAGAAACTTATTTTAATCTCATCCCTATTTATTTTCCTTTTCTGAAATGATCTTAAACAAAATAATTA AATAAAATAAAATAATGTGTGCATTATATTCTTTTAAATAAATTGTTATGAACATGTCATGTAATATTATCCTGCATTAT TACAAAAAAAAAAAAAAAAAAAAAAANNAGGGATCATATGTCCAGGANTATNTTTTTTNCGACCTCCATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28966: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28966319702T098700437m3gmbPfHB3.1, G. Roman Reddy


Date: 5:12:17 on Sat 18 Nov 117.